ID: 978351481_978351487

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 978351481 978351487
Species Human (GRCh38) Human (GRCh38)
Location 4:107824887-107824909 4:107824904-107824926
Sequence CCGCGCGCGGCGGGCGGGGAGAG GGAGAGCGGGCGCGGGGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 227} {0: 1, 1: 2, 2: 14, 3: 107, 4: 933}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!