|
Left Crispr |
Right Crispr |
| Crispr ID |
978353353 |
978353363 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:107844033-107844055
|
4:107844086-107844108
|
| Sequence |
CCTCTTTTTGCCAGGCACGGTGG |
GCCAAGACAGGCAGATCATGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 33, 3: 262, 4: 1203} |
{0: 26, 1: 874, 2: 4867, 3: 16301, 4: 36558} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|