ID: 978361243_978361245

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 978361243 978361245
Species Human (GRCh38) Human (GRCh38)
Location 4:107932474-107932496 4:107932490-107932512
Sequence CCTCGGAGAGAAACTTTGGCCCC TGGCCCCCATGTTAGAAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 71} {0: 1, 1: 0, 2: 1, 3: 13, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!