ID: 978443862_978443865

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 978443862 978443865
Species Human (GRCh38) Human (GRCh38)
Location 4:108762614-108762636 4:108762631-108762653
Sequence CCGGGGACTTTCGAGCGGGCAGG GGCAGGAAGCCCAGCGTTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 66} {0: 1, 1: 0, 2: 0, 3: 28, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!