ID: 978455825_978455828

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 978455825 978455828
Species Human (GRCh38) Human (GRCh38)
Location 4:108890308-108890330 4:108890334-108890356
Sequence CCAGCTTTACACTTATTTCATTG CTCAGGCACCAGGAAGTTACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 11, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!