ID: 978464551_978464558

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 978464551 978464558
Species Human (GRCh38) Human (GRCh38)
Location 4:108994414-108994436 4:108994467-108994489
Sequence CCATTGCTGAGGCTTGAGTAGCT CAAATGGGCAGAGCCCACTGCGG
Strand - +
Off-target summary {0: 55, 1: 1422, 2: 1640, 3: 1491, 4: 1396} {0: 1, 1: 0, 2: 0, 3: 25, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!