|
Left Crispr |
Right Crispr |
Crispr ID |
978470200 |
978470204 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:109057507-109057529
|
4:109057529-109057551
|
Sequence |
CCTGACTTCAGGTGACCTGCCGG |
GCCTTTGCCTCCCAAAGTGCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 29, 2: 1273, 3: 19008, 4: 52200} |
{0: 392, 1: 59777, 2: 230663, 3: 240054, 4: 156397} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|