|
Left Crispr |
Right Crispr |
| Crispr ID |
978470200 |
978470208 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:109057507-109057529
|
4:109057538-109057560
|
| Sequence |
CCTGACTTCAGGTGACCTGCCGG |
TCCCAAAGTGCTGGGATTATAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 29, 2: 1273, 3: 19008, 4: 52200} |
{0: 27231, 1: 315676, 2: 251783, 3: 138973, 4: 131031} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|