ID: 978488029_978488030

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 978488029 978488030
Species Human (GRCh38) Human (GRCh38)
Location 4:109278128-109278150 4:109278175-109278197
Sequence CCATCTCAAAAAAAAAAAAGAAG CTGAATCAGCATATCTATTCAGG
Strand - +
Off-target summary {0: 271, 1: 10111, 2: 101558, 3: 76320, 4: 94041} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!