|
Left Crispr |
Right Crispr |
| Crispr ID |
978508810 |
978508816 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:109492961-109492983
|
4:109492976-109492998
|
| Sequence |
CCTTCCACCTTGGCCTTCCAAAG |
TTCCAAAGTGTTGGGATAATAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118} |
{0: 3, 1: 179, 2: 5277, 3: 68511, 4: 360066} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|