ID: 978524177_978524186

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 978524177 978524186
Species Human (GRCh38) Human (GRCh38)
Location 4:109647842-109647864 4:109647874-109647896
Sequence CCCACATAATTGTGTGTCCGCAC CAGTGTAAGGAAGAGGTGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 24, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!