ID: 978555010_978555013 |
View in Genome Browser |
Spacer: 0 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 978555010 | 978555013 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 4:109970545-109970567 | 4:109970568-109970590 |
| Sequence | CCATGGGAAACAGGTTTTTAAAA | ATCTGTTGATGTGCTTTGGGAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 0, 2: 1, 3: 12, 4: 196} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||