ID: 978562303_978562310

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 978562303 978562310
Species Human (GRCh38) Human (GRCh38)
Location 4:110046069-110046091 4:110046112-110046134
Sequence CCTGCCTGAATATGTCTAGACAG TATGACCAGGGAGGACTGTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 106} {0: 1, 1: 0, 2: 0, 3: 24, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!