|
Left Crispr |
Right Crispr |
| Crispr ID |
978569785 |
978569793 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:110124299-110124321
|
4:110124338-110124360
|
| Sequence |
CCAACCCAAATGCCCACTAATGA |
AATGTGGTATATATACACCATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 200, 2: 3818, 3: 19084, 4: 10172} |
{0: 542, 1: 5227, 2: 28767, 3: 16574, 4: 9981} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|