ID: 978598557_978598561

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 978598557 978598561
Species Human (GRCh38) Human (GRCh38)
Location 4:110404245-110404267 4:110404291-110404313
Sequence CCGTCAAAAGTCTGCGTATAAGT ATTAGTAGCCTGCTGTTGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 94} {0: 1, 1: 7, 2: 51, 3: 237, 4: 470}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!