ID: 978625009_978625012

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 978625009 978625012
Species Human (GRCh38) Human (GRCh38)
Location 4:110675430-110675452 4:110675456-110675478
Sequence CCATGCATGTGTTTGTGTGTATA TAGTATATGTATTTGGAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 32, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!