ID: 978654243_978654252

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 978654243 978654252
Species Human (GRCh38) Human (GRCh38)
Location 4:111048165-111048187 4:111048211-111048233
Sequence CCCCAACCTCCAAGTGACATGAA AGGGAGAGCACAGTGATTGTGGG
Strand - +
Off-target summary No data {0: 23, 1: 59, 2: 130, 3: 192, 4: 423}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!