ID: 978661174_978661184

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 978661174 978661184
Species Human (GRCh38) Human (GRCh38)
Location 4:111128367-111128389 4:111128414-111128436
Sequence CCCAGGTCCACCTATCAAACTTG TACAAAGGGAAACAAGACAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 56, 4: 570}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!