ID: 978663364_978663368

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 978663364 978663368
Species Human (GRCh38) Human (GRCh38)
Location 4:111154192-111154214 4:111154220-111154242
Sequence CCAACATTCAGCAGGTCCTGAGG TCCTGTGTCCTGGAAGAATGAGG
Strand - +
Off-target summary No data {0: 3, 1: 72, 2: 176, 3: 457, 4: 861}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!