ID: 978735347_978735356

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 978735347 978735356
Species Human (GRCh38) Human (GRCh38)
Location 4:112077945-112077967 4:112077992-112078014
Sequence CCCAGCAGACGTTTGATGCCAAG CCTGCAAGGCTGCTACCTAATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 14, 3: 8, 4: 100} {0: 1, 1: 0, 2: 1, 3: 13, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!