ID: 978758741_978758747

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 978758741 978758747
Species Human (GRCh38) Human (GRCh38)
Location 4:112332195-112332217 4:112332217-112332239
Sequence CCTTCCTTAAATATAAAGCCTAT TGGTTTATCAATAAGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 273} {0: 1, 1: 0, 2: 0, 3: 25, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!