ID: 978764507_978764512

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 978764507 978764512
Species Human (GRCh38) Human (GRCh38)
Location 4:112390377-112390399 4:112390420-112390442
Sequence CCTCAATATAGGCTTGGCTATAA GCAGTTTACATTTGTTTGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 24, 4: 354}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!