ID: 978810089_978810093

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 978810089 978810093
Species Human (GRCh38) Human (GRCh38)
Location 4:112840097-112840119 4:112840132-112840154
Sequence CCTTGTCCTTCCTCTAACAGCAG ACATCTCTGCTTGAATTAACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 13, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!