ID: 978852296_978852298

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 978852296 978852298
Species Human (GRCh38) Human (GRCh38)
Location 4:113353725-113353747 4:113353749-113353771
Sequence CCAGTAAGAAGGAAATTAAAAGA AAGCAGAAACAAAAAGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 523} {0: 1, 1: 0, 2: 13, 3: 185, 4: 2107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!