ID: 978869350_978869360

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 978869350 978869360
Species Human (GRCh38) Human (GRCh38)
Location 4:113556652-113556674 4:113556690-113556712
Sequence CCAGTGTGCCAAGTCCATCCATT GGCTCCCCAAAGACCCCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 163} {0: 1, 1: 0, 2: 3, 3: 17, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!