ID: 978878735_978878738

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 978878735 978878738
Species Human (GRCh38) Human (GRCh38)
Location 4:113674456-113674478 4:113674490-113674512
Sequence CCTAAAGTTAAGAGCTTATTGCA CTTGATGCCCACAGTTTACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 156} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!