ID: 978892636_978892643

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 978892636 978892643
Species Human (GRCh38) Human (GRCh38)
Location 4:113848316-113848338 4:113848358-113848380
Sequence CCAGGTTCCTTCTGCAACACATG TTCAAGATGAGATTCGGGCGAGG
Strand - +
Off-target summary No data {0: 2, 1: 124, 2: 8026, 3: 12167, 4: 10627}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!