ID: 978911925_978911928

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 978911925 978911928
Species Human (GRCh38) Human (GRCh38)
Location 4:114074011-114074033 4:114074035-114074057
Sequence CCAACCTCATTCTGTGAAACCAG ATCATCCTGATACCAAAATATGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 123, 3: 744, 4: 3350} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!