ID: 978936946_978936955

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 978936946 978936955
Species Human (GRCh38) Human (GRCh38)
Location 4:114389238-114389260 4:114389281-114389303
Sequence CCAGCGCAAGCTGAGGTCTGAGG AGGTAGCTCAAAGAACACCTGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 15, 3: 70, 4: 211} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!