ID: 978957788_978957793

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 978957788 978957793
Species Human (GRCh38) Human (GRCh38)
Location 4:114635683-114635705 4:114635736-114635758
Sequence CCCCCTCATAAAAAAGATCCATT TGTAAATAAAACTTCAAATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 334} {0: 1, 1: 0, 2: 6, 3: 52, 4: 522}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!