|
Left Crispr |
Right Crispr |
| Crispr ID |
978977439 |
978977444 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:114895549-114895571
|
4:114895591-114895613
|
| Sequence |
CCAGAACTACAAAGAGGAACTGG |
GTTCTAAACAATTTAAAAGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 15, 2: 412, 3: 6496, 4: 5818} |
{0: 1, 1: 0, 2: 32, 3: 331, 4: 912} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|