ID: 979043678_979043681

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 979043678 979043681
Species Human (GRCh38) Human (GRCh38)
Location 4:115834524-115834546 4:115834544-115834566
Sequence CCAGCGCAGCAGTCTGAAGTCAG CAGCCTGGGACTCTCGAGCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 37, 3: 167, 4: 572}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!