ID: 979099586_979099599

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 979099586 979099599
Species Human (GRCh38) Human (GRCh38)
Location 4:116598714-116598736 4:116598762-116598784
Sequence CCTACACCACCGTCACCCCACAG TGCAGCAGCTGGTGCCAAAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 376} {0: 2, 1: 0, 2: 1, 3: 28, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!