ID: 979100216_979100220

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 979100216 979100220
Species Human (GRCh38) Human (GRCh38)
Location 4:116603641-116603663 4:116603679-116603701
Sequence CCCAAGGTCTCTTCAGTCAATTT TGTGCTGGTACTCACCATTCAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 50, 3: 299, 4: 641} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!