ID: 979112027_979112032

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 979112027 979112032
Species Human (GRCh38) Human (GRCh38)
Location 4:116770831-116770853 4:116770876-116770898
Sequence CCCTCCTCGTTCTGCTAATAGAG GGAAAAACATTCCATGCTCATGG
Strand - +
Off-target summary No data {0: 2077, 1: 12734, 2: 6989, 3: 4447, 4: 3846}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!