ID: 979136432_979136444

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 979136432 979136444
Species Human (GRCh38) Human (GRCh38)
Location 4:117117198-117117220 4:117117245-117117267
Sequence CCAGTCCTCACTGGGTTTTTGTA GGCTGTTGCAGGATTTAAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 13, 3: 39, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!