ID: 979177029_979177032

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 979177029 979177032
Species Human (GRCh38) Human (GRCh38)
Location 4:117678395-117678417 4:117678411-117678433
Sequence CCAGTCTCAGATATGTCTTTATT CTTTATTAGCAGTGGGAAAATGG
Strand - +
Off-target summary No data {0: 1, 1: 115, 2: 1378, 3: 1932, 4: 3550}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!