ID: 979205956_979205958

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 979205956 979205958
Species Human (GRCh38) Human (GRCh38)
Location 4:118038253-118038275 4:118038273-118038295
Sequence CCCTTAAGTCATATAGGGCAGAA GAATAAACAGCAAACAGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 127} {0: 1, 1: 0, 2: 3, 3: 31, 4: 346}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!