|
Left Crispr |
Right Crispr |
| Crispr ID |
979213391 |
979213407 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:118133372-118133394
|
4:118133423-118133445
|
| Sequence |
CCCCCTGTCACTGTGCTCTCCCT |
CATGGCCACTGCCGGGAGATAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 17, 2: 34, 3: 114, 4: 489} |
{0: 1, 1: 3, 2: 11, 3: 49, 4: 211} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|