ID: 979228039_979228046

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 979228039 979228046
Species Human (GRCh38) Human (GRCh38)
Location 4:118312833-118312855 4:118312879-118312901
Sequence CCTATCCCAAATAGCTCACTAGA ATAAGTGACCGAGGAGTAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 91} {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!