ID: 979230478_979230482

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 979230478 979230482
Species Human (GRCh38) Human (GRCh38)
Location 4:118343437-118343459 4:118343460-118343482
Sequence CCATATTCCATATGTGAAGGAAA CCTAAAAGAAATAGGAGAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 257} {0: 1, 1: 0, 2: 4, 3: 56, 4: 715}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!