ID: 979257370_979257380

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 979257370 979257380
Species Human (GRCh38) Human (GRCh38)
Location 4:118619324-118619346 4:118619358-118619380
Sequence CCCACCCCAGACTCCCAAGTAGC GTGTGCACCACCACCACACCTGG
Strand - +
Off-target summary {0: 31, 1: 494, 2: 16352, 3: 113220, 4: 215481} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!