ID: 979257378_979257380

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 979257378 979257380
Species Human (GRCh38) Human (GRCh38)
Location 4:118619337-118619359 4:118619358-118619380
Sequence CCCAAGTAGCTGGAACTACGGGT GTGTGCACCACCACCACACCTGG
Strand - +
Off-target summary {0: 25, 1: 990, 2: 20089, 3: 110666, 4: 252932} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!