ID: 979276007_979276013

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 979276007 979276013
Species Human (GRCh38) Human (GRCh38)
Location 4:118815051-118815073 4:118815081-118815103
Sequence CCAGCTTCTTCTGGGGCTGTGGC CCATCTGTGCAGGACCTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 8, 3: 237, 4: 5171} {0: 1, 1: 0, 2: 3, 3: 100, 4: 345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!