ID: 979309358_979309364

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 979309358 979309364
Species Human (GRCh38) Human (GRCh38)
Location 4:119184056-119184078 4:119184071-119184093
Sequence CCATCCACCTTCTCCTCCCAAAG TCCCAAAGTGCTGGGATTACAGG
Strand - +
Off-target summary {0: 1, 1: 16, 2: 1762, 3: 31024, 4: 113571} {0: 284556, 1: 262309, 2: 153276, 3: 130613, 4: 189623}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!