|
Left Crispr |
Right Crispr |
| Crispr ID |
979309358 |
979309367 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:119184056-119184078
|
4:119184084-119184106
|
| Sequence |
CCATCCACCTTCTCCTCCCAAAG |
GGATTACAGGTGCGAACCACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 16, 2: 1762, 3: 31024, 4: 113571} |
{0: 1, 1: 55, 2: 956, 3: 2366, 4: 2941} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|