ID: 979325868_979325877

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 979325868 979325877
Species Human (GRCh38) Human (GRCh38)
Location 4:119378846-119378868 4:119378899-119378921
Sequence CCTGTTGCTGTTTTCAAGGAGCC GCCCCTCATCTCTGCAGTTGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 16, 4: 160} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!