ID: 979349649_979349664

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 979349649 979349664
Species Human (GRCh38) Human (GRCh38)
Location 4:119628911-119628933 4:119628962-119628984
Sequence CCACCCGGGGTCCGGCAGTGTTC TTCCCAGGAGGCGGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 267} {0: 1, 1: 1, 2: 23, 3: 125, 4: 1039}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!