ID: 979438741_979438747

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 979438741 979438747
Species Human (GRCh38) Human (GRCh38)
Location 4:120726020-120726042 4:120726051-120726073
Sequence CCACTGCGAAGAGTGGCTGCTCA GGCACAAGGTAGAGTGCTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 101} {0: 1, 1: 0, 2: 1, 3: 7, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!