ID: 979474153_979474159

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 979474153 979474159
Species Human (GRCh38) Human (GRCh38)
Location 4:121135088-121135110 4:121135123-121135145
Sequence CCAGGCAGGAGGCCAGGGCTTAG CACCATGTCCTGTCACAGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 431} {0: 1, 1: 0, 2: 4, 3: 18, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!